Analysis code and amplicon sequencing data for "Contact-dependent intercellular dTMP transfer sustains tumor cell proliferation"

Abstract

This archive provides analysis code and raw mouse Kras/Trp53 amplicon sequencing data accompanying Contact-dependent intercellular dTMP transfer sustains tumor cell proliferation. Analyses include bulk RNA-seq differential expression (GSE271721), single-cell classification (GSE148071), Visium spatial neighborhood analysis (10x Genomics Human Lung Cancer, FFPE), spatial deconvolution and cell-state co-abundance analysis using cell2location and NMF (E-MTAB-13530; single-cell reference E-MTAB-13526), and amplicon gene-editing and mutation analysis. The amplicon dataset contains 33 paired-end libraries (17 Kras and 16 Trp53) from 17 mouse tissue specimens (10 KP tumors, five KPTT tumors and two normal lungs), with sample annotations, reference sequences and QC summaries. Other sequencing inputs are available through the linked public sources. Genomic DNA from KP/KPTT tumor or normal lung tissue from healthy mice was extracted with a Qiagen DNA-RNA kit and amplified across gRNA targets with Kras forward/reverse primers AACTTGTGGTGGTTGGAGCT/CTTTACAAGCGCACGCAGAC and Trp53 forward/reverse primers CGGCTCTGAGTATACCACCAT/CTACCACGCGCCTTCCTAC. PCR products were prepared with the NEBNext UltraExpress® DNA Library Prep Kit (NEB, # E3325S) and sequenced on an Illumina NovaSeq 6000 (67-10-10-51 cycles). Laboratory-authored code is licensed under MIT; study-generated amplicon data are licensed under CC BY 4.0.